crispr genome engineering tool (Benchling Inc)
86
Structured Review
Benchling Inc
crispr genome engineering tool
Crispr Genome Engineering Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+genome+engineering+tool/crispr+engineering+genome+tool/pmc12815461-137-33-32
Average 86 stars, based on 1 article reviews
Crispr Genome Engineering Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+genome+engineering+tool/crispr+engineering+genome+tool/pmc12815461-137-33-32
Average 86 stars, based on 1 article reviews
crispr genome engineering tool - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Knock-In:Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. To generate GMCL1 2x Flag knock-in HCT116 cells, an optimal gRNA target sequence closest to the genomic target site and a ~2 kb homologous recombination (HR) donor template was designed using the Benchling Sequencing:Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. To generate GMCL1 2x Flag knock-in HCT116 cells, an optimal gRNA target sequence closest to the genomic target site and a ~2 kb homologous recombination (HR) donor template was designed using the Benchling Homologous Recombination:Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. To generate GMCL1 2x Flag knock-in HCT116 cells, an optimal gRNA target sequence closest to the genomic target site and a ~2 kb homologous recombination (HR) donor template was designed using the Benchling CRISPR:Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. To generate GMCL1 2x Flag knock-in HCT116 cells, an optimal gRNA target sequence closest to the genomic target site and a ~2 kb homologous recombination (HR) donor template was designed using the Benchling Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. In brief, to generate GMCL1 -knockout U-2 OS cells, optimal gRNA target sequences closest to the start codon of the genes were designed using the Benchling Article Title: Distinct Perception Mechanisms of BACH1 Quaternary Structure Degrons by Two F-box Proteins under Oxidative Stress Article Snippet: Samples of the cell lysates were then prepared with NuPAGE LDS Sample Buffer (Thermo Fisher Scientific) supplemented with ꞵ-mercaptoethanol (Sigma-Aldrich) and changes in protein levels were visualized via Western blot. .. To generate FBXO22 knockout cells, optimal sgRNA target sequences were designed using the Benchling Article Title: Induction of IFIT1/IFIT3 and inhibition of Bcl-2 orchestrate the treatment of myeloma and leukemia via pyroptosis. Article Snippet: Induction of pyroptosis is proposed as a promising strategy for the treatment of hematological malignancies, but little is known.. In the present study, we find clioquinol (CLQ), an anti-parasitic drug, induces striking myeloma and leukemia cell pyroptosis on a drug screen.. RNA sequencing reveals that the interferon-inducible genes IFIT1 and IFIT3 are markedly upregulated and are essential for CLQ-induced GSDME activation and cell pyroptosis. Article Title: The E3 ligase RNF32 controls the IκB kinase complex and NF-κB signaling in intestinal stem cells. Article Snippet: Proteins were then eluted with Strep-Tactin Elution buffer (Iba 2-1000-025), and the eluate was incubated with anti-FLAG agarose resin and analyzed by mass spectrometry as described above. .. To generate RNF32-/- HCT116 and SW480 cells, three gRNAs targeting exon 1 and exon 8 or exon 1 and exon 7 were designed using the Benchling Article Title: microRNA-637/661 ameliorate hypoxic-induced pulmonary arterial hypertension by targeting TRIM29 signaling pathway Article Snippet: Lipofectamine ® 2000 was obtained from Invitrogen (Carlsbad, CA, USA). .. To generate TRIM29-knockout HPASMCs, optimal gRNA target sequences were designed via the Benchling Article Title: CDK-independent role of D-type cyclins in regulating DNA mismatch repair Article Snippet: .. In brief, to generate CCND1, CCND2, CDKN1A knockout cells, optimal gRNA target sequences closest to the start codon of the genes were designed using the Benchling Knock-Out:Article Title: GMCL1 controls 53BP1 stability and modulates taxane sensitivity Article Snippet: .. In brief, to generate GMCL1 -knockout U-2 OS cells, optimal gRNA target sequences closest to the start codon of the genes were designed using the Benchling Article Title: Distinct Perception Mechanisms of BACH1 Quaternary Structure Degrons by Two F-box Proteins under Oxidative Stress Article Snippet: Samples of the cell lysates were then prepared with NuPAGE LDS Sample Buffer (Thermo Fisher Scientific) supplemented with ꞵ-mercaptoethanol (Sigma-Aldrich) and changes in protein levels were visualized via Western blot. .. To generate FBXO22 knockout cells, optimal sgRNA target sequences were designed using the Benchling Article Title: CDK-independent role of D-type cyclins in regulating DNA mismatch repair Article Snippet: .. In brief, to generate CCND1, CCND2, CDKN1A knockout cells, optimal gRNA target sequences closest to the start codon of the genes were designed using the Benchling other:Article Title: Recognition of BACH1 quaternary structure degrons by two F-box proteins under oxidative stress. Article Snippet: FBXO22 gRNA (CTTCGTGTTGAGTAACCTGG) was cloned into pSpCas9(BB)-2A-GFP (px458), a gift from F. Zhang (Addgene plasmid #48138), using the following primers: CACCGCTTC GTGTTGAGTAACCTGG and aaacCCAGGTTACTCAACACGAAGC. Clone Assay:Article Title: The E3 ligase RNF32 controls the IκB kinase complex and NF-κB signaling in intestinal stem cells. Article Snippet: Proteins were then eluted with Strep-Tactin Elution buffer (Iba 2-1000-025), and the eluate was incubated with anti-FLAG agarose resin and analyzed by mass spectrometry as described above. .. To generate RNF32-/- HCT116 and SW480 cells, three gRNAs targeting exon 1 and exon 8 or exon 1 and exon 7 were designed using the Benchling |